187. Repeated DNA Sequences
1. Description
The DNA sequence is composed of a series of nucleotides abbreviated as ‘A’, ‘C’, ‘G’, and ‘T’.
- For example, “ACGAATTCCG” is a DNA sequence.
When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
2. Example
Example 1
Input: s = “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”
Output: [“AAAAACCCCC”,“CCCCCAAAAA”]
Example 2
Input: s = “AAAAAAAAAAAAA”
Output: [“AAAAAAAAAA”]
3. Constraints
- 1 <= s.length <= 10^5
- s[i] is either ‘A’, ‘C’, ‘G’, or ‘T’.
4. Solutions
Sliding Window & Hash Table
n = str.size()
Time complexity: O(n)
Space complexity: O(n)
class Solution {
public:
vector<string> findRepeatedDnaSequences(const string &str) {
unordered_map<char, int> binary = {{'A', 0}, {'C', 1}, {'G', 2}, {'T', 3}};
const int sequence_length = 10;
if (str.size() < sequence_length) {
return {};
}
int sequence = 0;
for (int i = 0; i < sequence_length; ++i) {
sequence = (sequence << 2) | binary[str[i]];
}
unordered_map<int, int> sequence_count = {{sequence, 1}};
vector<string> repeated_DNA;
for (int i = sequence_length; i < str.size(); ++i) {
sequence = (sequence << 2) & ((1 << (sequence_length * 2)) - 1) | binary[str[i]];
++sequence_count[sequence];
if (sequence_count[sequence] == 2) {
repeated_DNA.emplace_back(str.substr(i - sequence_length + 1, sequence_length));
}
}
return repeated_DNA;
}
};